TB927

Trypanosoma brucei Tb927.2.6100 is an essential protein ...

Eukaryot Cell. 2013 Jul;12(7):970-8. doi: 10.1128/EC.00352-12. Epub 2013 May 6. Trypanosoma brucei Tb927.2.6100 is an essential protein associated with ...

tb927

Tb927.6.2790 - L-threonine 3-dehydrogenase, putative ...

mitochondrion, L-threonine 3-dehydrogenase activity, threonine catabolic process.

tb927

Tb927.10.6900 encodes the glucosyltransferase involved in ...

Mol Biochem Parasitol. 2014 Aug;196(1):9-11. doi: 10.1016/j.molbiopara. 2014.07.005. Epub 2014 Jul 23. Tb927.10.6900 encodes the glucosyltransferase  ...

tb927

KEGG T01013: Tb927.8.2540

KEGG Orthology (KO) [BR:tbr00001] 09100 Metabolism 09103 Lipid metabolism 00071 Fatty acid degradation. Tb927.8.2540 00592 alpha-Linolenic acid ...

tb927

KEGG T01013: Tb927.5.2780

Tb927.5.2780 (Tb05.26K5.520) Enzymes [BR:tbr01000] 2. Transferases 2.7 Transferring phosphorus-containing groups 2.7.7 Nucleotidyltransferases 2.7.7.7  ...

tb927

KEGG T01013: Tb927.2.5800

Brite. Enzymes [BR:tbr01000] 3. Hydrolases 3.1 Acting on ester bonds 3.1.3 Phosphoric-monoester hydrolases 3.1.3.37 sedoheptulose-bisphosphatase. Tb927.

tb927

Table S2: Robustly regulated transcripts ID Long slender/ procyclics ...

Tb927.2.1700 up hypothetical protein, conserved. Tb927.2.1920 up expression site-associated gene (ESAG) protein, putative,expression site-associated.

tb927

KEGG T01013: Tb927.2.4610

KEGG Orthology (KO) [BR:tbr00001] 09100 Metabolism 09105 Amino acid metabolism 00270 Cysteine and methionine metabolism. Tb927.2.4610

tb927

KEGG T01013: Tb927.3.2900

KEGG Orthology (KO) [BR:tbr00001] 09120 Genetic Information Processing 09122 Translation 03013 RNA transport. Tb927.3.2900 09123 Folding, sorting and ...

tb927

KEGG T01013: Tb927.3.3330

Tb927.3.3330 09180 Brite Hierarchies 09182 Protein families: genetic information processing 03110 Chaperones and folding catalysts [BR:tbr03110] Tb927.

tb927

KEGG T01013: Tb927.8.5860

KEGG Orthology (KO) [BR:tbr00001] 09120 Genetic Information Processing 09122 Translation 03010 Ribosome Tb927.8.5860 09180 Brite Hierarchies

tb927

From Tb927 DB

Table S3: Proteins identified from PTP-P37 purification. 60S ribosomal proteins. Protein Name. (From Tb927 DB). Peptides. Identified. Unique peptides identified.

tb927

View popup

35G1, 2.00, 1.13, Tb927.1.1500 hypothetical conserved, GPI signal; predicted mRNA is 11 kb with a 6-kb 3′-UTR which contains many poly(U) tracts ...

tb927

Gene: Tb927.3.3470 - Summary - Trypanosoma brucei - Ensembl ...

Gene: Tb927.3.3470 . Description. cytochrome b5, putative. Location. Chromosome 3: 982,589-983,131 forward strand. TryBru_Apr2005_chr11: CP000066.1.

tb927

Tb927.3.3270 (Trypanosoma brucei brucei TREU927) | Gene Target ...

Gene target information for Tb927.3.3270 - ATP-dependent phosphofructokinase (Trypanosoma brucei brucei TREU927). Find diseases associated with this ...

tb927

Possible mRNA targets of ZC3H11.

4 Apr 2013 ... 2, Tb927.11.11330, Heat shock protein HSP70, 4.2, 0.2, 1.1, 0.5, yes. 3, Tb927. 10.10980, Heat shock protein HSP83, 3.9, 0.2, 0.7, 1.7, yes.

tb927

Deletion of Tb927.3.1830 causes a growth defect. (A) Alignment of ...

Deletion of Tb927.3.1830 causes a growth defect. (A) Alignment of Tb927.3.1830 with human, mouse and chicken RMI1. DUF1767 and OB-fold domains are ...

tb927

Trypanosoma brucei Tb927.2.6100 is an essential protein ...

Abstract: The mitochondrial DNA of trypanosomatid protozoa consists of a complex, intercatenated network of tens of maxicircles and thousands of...

tb927

TB-927+

TB-927+. TB,HSWA4-63DR+,DG984-1+,50 OHM Test Board(UNIT IS ON BOARD ) Generic photo used for illustration purposes only. Data, Drawings & ...

tb927

Trypanocyc

05/11/15, FADSYN-RXN, Gene and litterature added, Tb927.11.7420 was added based on EC number from OrthoMCL and PMID:24260300 added (manual).

tb927

View popup

... recognition (MSH2-MSH3), NM_000251, YOL090W, SPBC19G7.01c (B), LinJ. 33.0420 (B), LmjF.33.0410 (B), Tb927.10.11020 (B), Tc00.1047053507711.320 ...

tb927

Anti-Tb927.2.2470 Antibody Products | Biocompare.com

Compare Anti-Tb927.2.2470 Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.

tb927

GSE81764 - RNA-seq Transcriptome analysis of REG9.1 (Tb927 ...

Bloodstream forms of T brucei AnTat1.1 were grown in vitro and REG9.1 was silenced by tetracycline induction of RNAi Overall design: Two replicates of ...

tb927

KEGG T01013: Tb927.4.3810

KEGG Orthology (KO) [BR:tbr00001] 09120 Genetic Information Processing 09121 Transcription 03020 RNA polymerase. Tb927.4.3810 09180 Brite Hierarchies

tb927

PDF + SI

Tb927.6.3750 and Tb927.6.3800) and cytoplasmic HSP70.4. (Tb927.7.710) ( Searle and Smith, 1993), which all decreased in response to heat shock, similar to ...

tb927

Supp Fig 3.pdf

15 Aug 2012 ... TbPFK, Tb927.8.5120, Tb11.02.4440, Tb927.8.3530, Tb11.47.0004,. TCP-1-beta, Tb927.3.3780, GDH, Tb11.01.1920, Tb927.8.730,. RISP, TIM ...

tb927

KKT2 1024-1260 W1048A

13 Dec 2019 ... 30, Tb927.7.5590, 4, 1645, Domain of unknown function (DUF3883), putative. 31, Tb927.10.4740, 2, 63, nucleolar RNA-binding protein, ...

tb927

Chemogenetic Characterization of Inositol Phosphate Metabolic ...

ANOVA P-value. Tb927.4.1140. TbPI4K. C37 (GW525701). 5.03 (UP). <0.001. Tb927.9.12470. TbIPMK. C20 (GSK1723980). 3.00 (UP). <0.01. Tb927.9.12470.

tb927

Table S1, XLSX file, 0.01 MB

3, 2, Tb927.11.1320, NDUFS7 (NDHK), NADH-ubiquinone oxidoreductase 20 kDa subunit, 202, OxPhos complex I, missing, no hit, OG5_127327, 19, 0, N/A.

tb927

View popup

2, pLEW100-MetRS-3v5, Tb927.10.1500, CCCAAGCTT ATGGCTCTAAAGCTGCTTTCAGA, CCCAGATCT TGTACTCTTTGTATTCTCTGTTGAGCG.

tb927

Tb927.2.6320

3 Jan 2019 ... Research Topics, Genomes and Genes, Scientific Experts, Publications, Species about Tb927.2.6320.

tb927

Unusually protein-rich mitochondrial ribosomes in Trypanosoma ...

24 Mar 2008 ... Tb927.4.3690(HP); TAPSSU5 – Tb927.5.1510(HP), TAPSSU6 –Tb927.6.2080 ( HP). The TAP- plasmids were linearized with NotI enzyme and ...

tb927

Development of Chemical Proteomics for the Folateome and ...

28 Sep 2019 ... 12, CZT00006537.2, TB927.8.6460, HYPOTHETICAL PROTEIN, ... 0.66, 1.03, 1.04, 1, Tb927.8.6460, kinase binding protein CGI-121, putative.

tb927

(PDF) Tb927.10.6900 encodes the glucosyltransferase involved in ...

Tb927.10.6900 encodes the glucosyltransferase involved in synthesis of base J in Trypanosoma brucei. Peter J Myler. Molecular & Biochemical Parasitology ...

tb927

Trypanosoma brucei Tb927.2.6100 is an essential protein ...

We identified a novel protein encoded by Tb927.2.6100 that was present in a fraction enriched for kDNA and colocalized the protein with kDNA by fluorescence ...

tb927

Molecular and Biochemical Parasitology | Vol 196, Issue 1, Pages 1 ...

Tb927.10.6900 encodes the glucosyltransferase involved in synthesis of base J in Trypanosoma brucei. Aarthi Sekar, Christopher Merritt, Loren Baugh, Kenneth  ...

tb927

tb(lm)

tbr:Tb10.70.5360 tbr:Tb10.70.6680 tbr:Tb927.3.1220 tbr:Tb927.3.3890 tbr:Tb927. 4.1030 tbr:Tb927.5.920 tbr:Tb927.5.3590 tbr:Tb927.6.1950 tbr:Tb927.6.4710 ...

tb927

tbr:Tb10.70.6620 tbr:Tb10.70.4600 tbr:Tb927.5.1000 tbr:Tb927 ...

tbr:Tb10.70.6620 tbr:Tb10.70.4600 tbr:Tb927.5.1000 tbr:Tb927.8.6210 tbr:Tb927. 8.6170 tbr:Tb10.389.0630 tbr:Tb927.3.4000 tbr:Tb927.6.4780 tbr:Tb10.70.6450 ...

tb927

tbr:Tb11.01.8470 tbr:Tb10.70.6620 tbr:Tb927.5.1000 tbr:Tb927 ...

tbr:Tb11.01.8470 tbr:Tb10.70.6620 tbr:Tb927.5.1000 tbr:Tb927.8.6210 tbr:Tb927. 8.6170 tbr:Tb10.389.0630 tbr:Tb927.3.4000 tbr:Tb927.6.4780 tbr:Tb927.6.4980 ...

tb927

Casein kinase 1 isoform 2 is essential for bloodstream form ...

17 Sep 2013 ... Abstract. Induction of RNA interference targeted against casein kinase 1 isoform 2 (TbCK1.2, Tb927.5.800) in bloodstream form Trypanosoma ...

tb927

Comments



Subscribe martilenvamo.ml